kinC [2019-08-26 10:20:03]

two-component sensor kinase, phosphorylates Spo0F and Spo0A, part of the phosphorelay, governs expression of genes involved in biofilm formation

Locus: BSU_14490

Isoelectric point: 6.22

Molecular weight: 48.68 kDa

Protein length: 428 aa

Gene length: 1287 bp

Function: initiation of sporulation

Product: two-component sensor kinase

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Two-component sensor kinase
• Information processing → Regulation of gene expression → phosphorelay → The kinases
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Regulation
• Lifestyles → Sporulation → phosphorelay → The kinases
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 1,518,333 1,519,619

Phenotypes of a mutant

• defective in biofilm formation PubMed

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation of Spo0F as part of the phosphorelay, but also direct phosphorylation of Spo0A PubMed
• mainly active in the younger, outer regions of a colony (with KinD) PubMed
• phosphorylates Spo0A in response to the presence of surfactin PubMed, this has been refuted PubMed
• required for initiation of sliding together with KinB PubMed

Domains

• two transmembrane segments
• PAS domain
• C-terminal histidine phosphotransferase domain

Modification

• autophosphorylation on a His residue

Effectors of protein activity

• activity is triggered by potassium leakage PubMed, this has been refuted PubMed
• activity is triggered by polyisoprenoid lipids formed by YisP PubMed
• activity is stimulated by the interaction with FloT PubMed

Structure

• 3A0R (HK-RR complex from Thermotoga maritima, 28% identity) PubMed

Localization

• cell membrane (Heterogeneous) PubMed
• co-localizes with FloT in discrete foci in the membrane PubMed
• the localization of KinC in membrane microdomains depends on FloA and FloT PubMed, this has been refuted PubMed

Expression and Regulation

Operons

• Genes: kinC-ykqA-ktrC
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spo0A: activation, PubMed, in Spo0A regulon

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• 1A632 ( kinC::erm), PubMed, available at BGSC
• BAL393 (kinC::spc)PubMed
• BKE14490 (kinC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATGACCACCTGCCGCTT, downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA
• BKK14490 (kinC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATGACCACCTGCCGCTT, downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA

References

Reviews

Loading

Original publications

Loading